Logo Annals of Transplantation Logo Annals of Transplantation Logo Annals of Transplantation

01 September 2026 : Original article  

Protective Effects of Quercetin and Sucrose on Cold Preservation Injury in Porcine Kidneys Donated After Cardiac Death

Daisuke Ishii BCDEF 1,2, Asuka Toriumi BCDEF 1, Hiromichi Obara ORCID logo ABCE 3, Yoshiyasu Satake BC 1, Yoko Okada BC 2, Haruka Dewa G 4, Masashi Imamura G 4, Naoto Matsuno ABCDEG 1,2*

DOI: 10.12659/AOT.952503

Ann Transplant 2026; 31:e952503

Table 1 PCR primers.

PrimerForwardReverse
GAPDHAGGAGTAAGAGCCCCTGGACGTGTGTTGGGGGATCGAGT
TNF-αTTGTCGCTACATCGCTGAACCCAGTAGGGCGGTTACAGAC
IFN-γTTCAGCTTTGCGTGACTTTGTGCATTAAAATAGTCCTTTAGGATCG
Caspase-3GAATGGCATGTCGATCTGGTTTGTGAAGGTCTCCCTGAGATT

Your Privacy

We use cookies to ensure the functionality of our website, to personalize content and advertising, to provide social media features, and to analyze our traffic. If you allow us to do so, we also inform our social media, advertising and analysis partners about your use of our website, You can decise for yourself which categories you you want to deny or allow. Please note that based on your settings not all functionalities of the site are available. View our privacy policy.

Annals of Transplantation eISSN: 2329-0358
Annals of Transplantation eISSN: 2329-0358